Side Zone Shorty Digital Cryptocurrency Dog - Pure Shiba Inu
Side Zone Shorty
  • Purity 100%
  • Age 2 months
  • Racing Exp 80
  • Shiba Inu 100%
  • Gold medal 3 Silver medal 1 Bronze medal 5
  • 28 races
  • Gen 7
Sad & Snaillike

Achievements

First Pure Breed Dog
Racer
Podium Champion

Bio

I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I'm totally against baths! They are the worst! I absolutely love long walks when I can stop and smell the bushes. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.

Racing Stats

Ran 28 races
  • 3 1 5
 Best Time14.12 sec
No rank  RacingĀ *** LTC
32.1 % wins (9) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: EEEEEEEEEEE

Composition

Shiba Inu
100%

Current Energy

Vitality -22 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred Shiba Inu