Cassie Cage Chevy Litecoin Dog - Mix of Shiba Inu and Beagle
Cassie Cage Chevy
  • Purity 82%
  • Age 11 months
  • Racing Exp 0
  • Shiba Inu 91%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 6
Depressed & Snaillike

Achievements

None

Bio

Hey dawg! I'm Cassie Cage Chevy. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I live life by my favorite quote "Every dog has it's day", but every day is my day! I'm looking to share time together and not just to be an accessory.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTACTAGTAGTAGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
C
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: EEEEEDEEEEE

Composition

Shiba Inu
91%
Beagle
9%

Current Energy

Vitality -38 points
Lunar Effect +4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu