Patty Pokey Crypto Dog - Mix of Shiba Inu, Yorkshire Terrier, Beagle and Rottweiler
Patty Pokey
  • Purity 52%
  • Age 4 months
  • Racing Exp 0
  • Shiba Inu 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Depressed & Snaillike

Achievements

None

Bio

What's your favorite bed? Mine is the dirty laundry. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm willing to try little bondage, so my human chained me up!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGTAGTAGTATTACTAGTACACGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
T
T
A
C
T
A
G
T
A
C
A
C
G
T
A
G
T
A
G
T
A
Genes: EEEEFDEHEEE

Composition

Shiba Inu
73%
Yorkshire Terrier
9%
Beagle
9%
Rottweiler
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Beagle
Snout Shiba Inu
Mouth Rottweiler
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu