Grady Griffen Bitcoin Dog - Mix of Shiba Inu, Beagle, Yorkshire Terrier and Grey Wolf
Grady Griffen
  • Purity 39%
  • Age 2 months
  • Racing Exp 0
  • Shiba Inu 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

It's a barkin' beautiful day! Grady Griffen here. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I'm looking for a hard-working service animal who can keep up with me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGTAGTAGTATTACTAGTACCCGTAGTACTA
G
T
A
G
T
A
G
T
A
G
T
A
T
T
A
C
T
A
G
T
A
C
C
C
G
T
A
G
T
A
C
T
A
Genes: EEEEFDELEED

Composition

Shiba Inu
64%
Beagle
18%
Yorkshire Terrier
9%
Grey Wolf
9%

Current Energy

Vitality -14 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Beagle
Snout Shiba Inu
Mouth Grey Wolf
Nose Shiba Inu
Eyes Shiba Inu
Color Beagle