Vixen Velvet Cryptocurrency Dog - Mix of Schnauzer, Boxer, Golder Retriever, Labrador, Dachshund and German Shepard
Vixen Velvet
  • Purity 20%
  • Age 6 months
  • Racing Exp 0
  • Schnauzer 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Depressed & Snaillike

Achievements

None

Bio

Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I like to work out by digging fresh holes in landscaped yards. I don't mind sharing my bed with someone I just met, if we can cuddle. Finding the 'one' out of the pack that I can spend my life with...that's what I want.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAAACATAATACCAAACATAATAGGATCAATA
A
G
A
A
A
C
A
T
A
A
T
A
C
C
A
A
A
C
A
T
A
A
T
A
G
G
A
T
C
A
A
T
A
Genes: 8GCC5GCCA7C

Composition

Schnauzer
45%
Boxer
18%
Golder Retriever
9%
Labrador
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -57 points
Lunar Effect -10 points

Traits Breakdown

Body Golder Retriever
Tail Boxer
Legs Schnauzer
Front Legs Schnauzer
Head Labrador
Ears Boxer
Snout Schnauzer
Mouth Schnauzer
Nose Dachshund
Eyes German Shepard
Color Schnauzer