Fletcher Finn Litecoin Game Dog - Mix of Shiba Inu, Beagle, Grey Wolf and Pitbull terrier
Fletcher Finn
  • Purity 39%
  • Age 9 months
  • Racing Exp 0
  • Shiba Inu 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Depressed & Snaillike

Achievements

None

Bio

Hello, I'm Fletcher Finn. How's it goin'? My AI may be artificial, but at least I'm intelligent. Oh, go ahead. Pet me. I know you want to. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTACTAGTACCCGTATCCCTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
C
T
A
G
T
A
C
C
C
G
T
A
T
C
C
C
T
A
Genes: EEEEEDELEND

Composition

Shiba Inu
64%
Beagle
18%
Grey Wolf
9%
Pitbull terrier
9%

Current Energy

Vitality -43 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Grey Wolf
Nose Shiba Inu
Eyes Pitbull terrier
Color Beagle