Elena Elmo Digital Cryptocurrency Dog - Mix of Shiba Inu, Beagle, German Shepard, Labrador BK and Rottweiler
Elena Elmo
  • Purity 29%
  • Age 9 months
  • Racing Exp 0
  • Shiba Inu 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

Here in cyberspace, I ain't got much use for a floppy disc. The place I like most in the world is curled up in my human's bed, hogging all the covers! I like to work out by digging fresh holes in landscaped yards. I'm a serial monogamist. I don't understand why my human tries to give me tap water. I expect filtered and distilled!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAGTAGTAGTAGTACTAGTAGCAGTACACCTA
T
C
A
G
T
A
G
T
A
G
T
A
G
T
A
C
T
A
G
T
A
G
C
A
G
T
A
C
A
C
C
T
A
Genes: 7EEEEDE6EHD

Composition

Shiba Inu
55%
Beagle
18%
German Shepard
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -31 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Labrador BK
Nose Shiba Inu
Eyes Rottweiler
Color Beagle