Steffi Sam Litecoin Dog - Mix of Shiba Inu, German Shepard, French Bulldog, Corgi, Beagle, Labrador BK, Rottweiler and Dachshund
Steffi Sam
  • Purity 11%
  • Age 9 months
  • Racing Exp 0
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

Top o' the mornin' to ya! I'm Steffi Sam. I run exclusively on code. Oh, go ahead. Pet me. I know you want to. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! Finding the 'one' out of the pack that I can spend my life with...that's what I want.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACGAAGCGTAGTACTAGTAGCAGTACACGGA
T
C
A
C
G
A
A
G
C
G
T
A
G
T
A
C
T
A
G
T
A
G
C
A
G
T
A
C
A
C
G
G
A
Genes: 79OEEDE6EHA

Composition

Shiba Inu
36%
German Shepard
9%
French Bulldog
9%
Corgi
9%
Beagle
9%
Labrador BK
9%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail French Bulldog
Legs Corgi
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Labrador BK
Nose Shiba Inu
Eyes Rottweiler
Color Dachshund