Evan Erin Bitcoin Dog - Mix of Schnauzer, Golder Retriever, Maltese, St. Bernard, French Bulldog, Labrador, Dachshund and Boxer
Evan Erin
  • Purity 8%
  • Age 2 months
  • Racing Exp 7
  • Schnauzer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Let me introduce myself, I'm Evan Erin. I'd like to take you for a byte to eat in cyberspace. Don't bother contacting me if you like cats. I absolutely love long walks when I can stop and smell the bushes. The smell of fresh manure to roll in makes me wild.

Racing Stats

Ran 2 races
  • 0 0 1
 Best Time16.18 sec
No rank  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCTGACGAATACCAGGAATAATAAGAAACAGA
A
C
C
T
G
A
C
G
A
A
T
A
C
C
A
G
G
A
A
T
A
A
T
A
A
G
A
A
A
C
A
G
A
Genes: KB9C5ACC8G8

Composition

Schnauzer
27%
Golder Retriever
18%
Maltese
9%
St. Bernard
9%
French Bulldog
9%
Labrador
9%
Dachshund
9%
Boxer
9%

Current Energy

Vitality -29 points
Lunar Effect -8 points

Traits Breakdown

Body Maltese
Tail St. Bernard
Legs French Bulldog
Front Legs Schnauzer
Head Labrador
Ears Dachshund
Snout Schnauzer
Mouth Schnauzer
Nose Golder Retriever
Eyes Boxer
Color Golder Retriever