Karma Kirby Crypto Game Dog - Mix of Shiba Inu, Pitbull terrier, Golder Retriever, Corgi, Border Collie, Beagle, Maltese, Labrador BK, Rottweiler and Dachshund
Karma Kirby
  • Purity 1%
  • Age 10 months
  • Racing Exp 14
  • Shiba Inu 18%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

A-yo...Call me Karma Kirby. Power outages and computer viruses scare me! My humans say I slobber too much, but hey, I'm just juicy. I like shaking my fur next to humans right after a good swim! As a designer, I suggest low windows or couch backs next to windows without curtains. Just looking to sow some wild oats here...

Racing Stats

Ran 3 races
  • 0 1 1
 Best Time15.43 sec
No rank  RacingĀ *** LTC
66.7 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCAGAAGCGTATACCTAACCGCAGTACACGGA
T
C
C
A
G
A
A
G
C
G
T
A
T
A
C
C
T
A
A
C
C
G
C
A
G
T
A
C
A
C
G
G
A
Genes: N8OEJDK6EHA

Composition

Shiba Inu
18%
Pitbull terrier
9%
Golder Retriever
9%
Corgi
9%
Border Collie
9%
Beagle
9%
Maltese
9%
Labrador BK
9%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -35 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Corgi
Front Legs Shiba Inu
Head Border Collie
Ears Beagle
Snout Maltese
Mouth Labrador BK
Nose Shiba Inu
Eyes Rottweiler
Color Dachshund