Midna Mookie Bitcoin Dog - Mix of Husky, Shiba Inu, French Bulldog, Border Collie, Grey Wolf, Rottweiler, Schnauzer, Dachshund, Golder Retriever and Boxer
Midna Mookie
  • Purity 3%
  • Age 6 months
  • Racing Exp 1
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

If you'd like to get together, I'm Midna Mookie. I'm the best at running circle 8's. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. Fences are just challenges...I don't let them stop me! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.47 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAGTACGATACCCCCACATAGGAAGAAACACA
A
C
A
G
T
A
C
G
A
T
A
C
C
C
C
C
A
C
A
T
A
G
G
A
A
G
A
A
A
C
A
C
A
Genes: 4E9JLHCA8G4

Composition

Husky
18%
Shiba Inu
9%
French Bulldog
9%
Border Collie
9%
Grey Wolf
9%
Rottweiler
9%
Schnauzer
9%
Dachshund
9%
Golder Retriever
9%
Boxer
9%

Current Energy

Vitality -18 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs French Bulldog
Front Legs Border Collie
Head Grey Wolf
Ears Rottweiler
Snout Schnauzer
Mouth Dachshund
Nose Golder Retriever
Eyes Boxer
Color Husky