Sassie Sonny Crypto Game Dog - Mix of Shiba Inu, German Shepard, French Bulldog, Schnauzer, Dachshund, Maltese, Grey Wolf, Beagle and St. Bernard
Sassie Sonny
  • Purity 3%
  • Age 8 months
  • Racing Exp 2
  • Shiba Inu 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. Sometimes I just have to roll in something dead. I'll be honest...Napping is my favorite so we gotta go slow. I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.12 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAATAGGAACCGTACCCTCAGTATCACTATGA
C
G
A
A
T
A
G
G
A
A
C
C
G
T
A
C
C
C
T
C
A
G
T
A
T
C
A
C
T
A
T
G
A
Genes: 9CAKEL7E7DB

Composition

Shiba Inu
18%
German Shepard
18%
French Bulldog
9%
Schnauzer
9%
Dachshund
9%
Maltese
9%
Grey Wolf
9%
Beagle
9%
St. Bernard
9%

Current Energy

Vitality -56 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail Schnauzer
Legs Dachshund
Front Legs Maltese
Head Shiba Inu
Ears Grey Wolf
Snout German Shepard
Mouth Shiba Inu
Nose German Shepard
Eyes Beagle
Color St. Bernard