Weaver Woofer Bitcoin Dog - Mix of German Shepard, Schnauzer, Yorkshire Terrier, Maltese, Dachshund, Pitbull terrier and French Bulldog
Weaver Woofer
  • Purity 11%
  • Age 9 months
  • Racing Exp 74
  • German Shepard 27%
  • Gold medal 3 Silver medal 3 Bronze medal 1
  • 30 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Hi! I'm Weaver Woofer! I make the best virtual pet. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I love it when you show a little teeth. I don't like going to the groomer. Leave my beautiful fur alone! Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 30 races
  • 3 3 1
 Best Time15.05 sec
Rank 49  RacingĀ *** LTC
23.3 % wins (7) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCATAGGATCCTCATTATTATCATCACGAATA
A
C
C
A
T
A
G
G
A
T
C
C
T
C
A
T
T
A
T
T
A
T
C
A
T
C
A
C
G
A
A
T
A
Genes: KCAN7FF779C

Composition

German Shepard
27%
Schnauzer
18%
Yorkshire Terrier
18%
Maltese
9%
Dachshund
9%
Pitbull terrier
9%
French Bulldog
9%

Current Energy

Vitality -45 points
Lunar Effect +2 points

Traits Breakdown

Body Maltese
Tail Schnauzer
Legs Dachshund
Front Legs Pitbull terrier
Head German Shepard
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth German Shepard
Nose German Shepard
Eyes French Bulldog
Color Schnauzer