Chad Cujo Crypto Dog - Mix of Golder Retriever and Border Collie
Chad Cujo
  • Purity 82%
  • Age 3 months
  • Racing Exp 6
  • Golder Retriever 91%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 8
Depressed & Snaillike

Achievements

Racer

Bio

Little Bow Wow is my favorite musician. I just assume he's a dog... My bark alone scares birds out of my yard. When I hook up, I stay hooked up for about 20 minutes. I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time15.40 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAAGAAGAAGATACAGAAGAAGAAGAAGAAGA
A
G
A
A
G
A
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
Genes: 8888J888888

Composition

Golder Retriever
91%
Border Collie
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever