Lou Lady Rover Litecoin Game Dog - Mix of Golder Retriever and Grey Wolf
Lou Lady Rover
  • Purity 82%
  • Age 6 months
  • Racing Exp 0
  • Golder Retriever 91%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 7
Depressed & Snaillike

Achievements

None

Bio

My name is Lou Lady Rover and I'd really like to sniff you. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I am not above stealing food off humans' plates. Shy dogs that tuck tail bore me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAAGAAGAAGACCCAGAAGAAGAAGAAGAAGA
A
G
A
A
G
A
A
G
A
A
G
A
C
C
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
Genes: 8888L888888

Composition

Golder Retriever
91%
Grey Wolf
9%

Current Energy

Vitality -22 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Grey Wolf
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever