Shibe Snoopy Digital Cryptocurrency Game Dog - Mix of Golder Retriever, Border Collie and Poodle
Shibe Snoopy
  • Purity 51%
  • Age 12 months
  • Racing Exp 0
  • Golder Retriever 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 6
Sad & Tardy

Achievements

None

Bio

The cloud's my neighborhood. I'm not into dog collars, unless you're into S & M. My humans say I slobber too much, but hey, I'm just juicy. Steak is my absolute favorite, but I prefer to eat chicken for my health. I'm looking for a good Tug-O-War partner.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAGACAGAAGATACAGAAGATACAGAAGAAGA
A
G
A
G
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
A
G
A
Genes: 8I88J88J888

Composition

Golder Retriever
73%
Border Collie
18%
Poodle
9%

Current Energy

Vitality -5 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Poodle
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever