Jett Jalopy Crypto Game Dog - Mix of Golder Retriever, Border Collie, Schnauzer and Poodle
Jett Jalopy
  • Purity 39%
  • Age 5 months
  • Racing Exp 0
  • Golder Retriever 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Depressed & Snaillike

Achievements

None

Bio

Hey dawg! I'm Jett Jalopy. The Ethernet where I live, rocks. I am not above stealing food off humans' plates. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATAGACAGAAGATACAGAAGATACAGAAGAAGA
A
T
A
G
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
A
G
A
Genes: CI88J88J888

Composition

Golder Retriever
64%
Border Collie
18%
Schnauzer
9%
Poodle
9%

Current Energy

Vitality -24 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Poodle
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever