Agatha Axle Bitcoin Dog - Mix of Golder Retriever, Schnauzer, Poodle and Border Collie
Agatha Axle
  • Purity 39%
  • Age 12 months
  • Racing Exp 0
  • Golder Retriever 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Sad & Tardy

Achievements

None

Bio

I love unconditionally. Sometimes I forget where I buried my bone. The place I like most in the world is curled up in my human's bed, hogging all the covers! I hate it when other dogs pee in my yard! IT'S MY YARD!!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATAGACAGAAGATACAGAAGAATAAGAAGAAGA
A
T
A
G
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
A
T
A
A
G
A
A
G
A
A
G
A
Genes: CI88J88C888

Composition

Golder Retriever
64%
Schnauzer
18%
Poodle
9%
Border Collie
9%

Current Energy

Vitality -24 points
Lunar Effect -4 points

Traits Breakdown

Body Schnauzer
Tail Poodle
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Schnauzer
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever