Bugsey Bork Crypto Dog - Mix of Golder Retriever, Border Collie, Schnauzer, Pug and Rottweiler
Bugsey Bork
  • Purity 16%
  • Age 6 months
  • Racing Exp 0
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

Nice to meet you! I'm Bugsey Bork. I don't like to be ignored. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! Too much steak gives me the runs! My favorite way to spend playtime is a good game of frisbee.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  Racing *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total *** LTC

DNA Analysis

DNA Sequence: TACGAAAGAATATACAGAAGATACAGAATACAC
T
A
C
G
A
A
A
G
A
A
T
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
T
A
C
A
C
Genes: J28CJ88J8CH

Composition

Golder Retriever
36%
Border Collie
27%
Schnauzer
18%
Pug
9%
Rottweiler
9%

Current Energy

Vitality -26 points
Lunar Effect -6 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Golder Retriever
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Schnauzer
Color Rottweiler