Pippin Puppy Bitcoin Dog - Mix of Golder Retriever, Border Collie, Poodle, Schnauzer, St. Bernard and Dachshund
Pippin Puppy
  • Purity 15%
  • Age 6 months
  • Racing Exp 0
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Depressed & Snaillike

Achievements

None

Bio

I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I love waking up early then indulging in long afternoon naps. I think hamsters and cats are both over-rated. I am looking for my best friend, lover, and equal partner to share my food bowl.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACGACAGAATATACAGAAGATACAGATGAGGA
T
A
C
G
A
C
A
G
A
A
T
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
T
G
A
G
G
A
Genes: JI8CJ88J8BA

Composition

Golder Retriever
36%
Border Collie
27%
Poodle
9%
Schnauzer
9%
St. Bernard
9%
Dachshund
9%

Current Energy

Vitality -21 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Poodle
Legs Golder Retriever
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes St. Bernard
Color Dachshund