Dragster Deuce Litecoin Dog - Mix of Golder Retriever, Border Collie, Schnauzer, Pug and Dachshund
Dragster Deuce
  • Purity 16%
  • Age 12 months
  • Racing Exp 7
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 4
Sad & Tardy

Achievements

Racer

Bio

Hey! My name's Dragster Deuce! I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I'm sick of having my nails clipped, those are to help me dig! I love car rides when I can stick my head out the window. If I can't reach it to clean it myself, it doesn't need cleaning!

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.78 sec
Rank 63  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACGAAAGAATATACAGAAGATACAGAATAGGA
T
A
C
G
A
A
A
G
A
A
T
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
T
A
G
G
A
Genes: J28CJ88J8CA

Composition

Golder Retriever
36%
Border Collie
27%
Schnauzer
18%
Pug
9%
Dachshund
9%

Current Energy

Vitality -26 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Golder Retriever
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Schnauzer
Color Dachshund