Artie Ariel Bitcoin Dog - Mix of Grey Wolf, Shiba Inu, Border Collie, Corgi, Pitbull terrier and Dachshund
Artie Ariel
  • Purity 27%
  • Age 18 months
  • Racing Exp 0
  • Grey Wolf 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 9
Sad & Tardy

Achievements

None

Bio

I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I'm going kill that damn Nyan Cat if I can catch it. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  Racing *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total *** LTC

DNA Analysis

DNA Sequence: GTACCCCCCTACAGCCCCCCCTCCCCCCCCGGA
G
T
A
C
C
C
C
C
C
T
A
C
A
G
C
C
C
C
C
C
C
T
C
C
C
C
C
C
C
C
G
G
A
Genes: ELLJOLLNLLA

Composition

Grey Wolf
55%
Shiba Inu
9%
Border Collie
9%
Corgi
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -34 points
Lunar Effect -14 points

Traits Breakdown

Body Shiba Inu
Tail Grey Wolf
Legs Grey Wolf
Front Legs Border Collie
Head Corgi
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Grey Wolf
Color Dachshund