Snoopy Sophie Litecoin Game Dog - Mix of Husky, Corgi, Schnauzer, Grey Wolf, Boxer, St. Bernard, Maltese, Rottweiler, Golder Retriever and German Shepard
Snoopy Sophie
  • Purity 1%
  • Age 7 months
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

I enjoy exploration and am game for anything doggy-style. Oh, go ahead. Pet me. I know you want to. Squeaky toys are the best, don't you agree? Peanut butter is delish but I HATE when it sticks to the roof of my mouth. If you are looking for a pooch who's in touch with feelings, here I am.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCACAATACCCAACTGAACCCACAGATCAACA
A
G
C
A
C
A
A
T
A
C
C
C
A
A
C
T
G
A
A
C
C
C
A
C
A
G
A
T
C
A
A
C
A
Genes: O4CLGBKH874

Composition

Husky
18%
Corgi
9%
Schnauzer
9%
Grey Wolf
9%
Boxer
9%
St. Bernard
9%
Maltese
9%
Rottweiler
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -40 points
Lunar Effect -8 points

Traits Breakdown

Body Corgi
Tail Husky
Legs Schnauzer
Front Legs Grey Wolf
Head Boxer
Ears St. Bernard
Snout Maltese
Mouth Rottweiler
Nose Golder Retriever
Eyes German Shepard
Color Husky

Parents

No Children

Gift