Pee Wee Phoenix Litecoin Dog - Mix of Grey Wolf, Border Collie, Corgi, Golder Retriever, Pug and Schnauzer
Pee Wee Phoenix
  • Purity 18%
  • Age 11 months
  • Racing Exp 2
  • Grey Wolf 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

The cloud's my neighborhood. Slipping my collar, running off and making my humans worried? Every chance I get. I slept with a cat and I liked it. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I am looking for dogs I can run around town with...not looking for exclusivity.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time15.00 sec
Rank 42  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACAGCCCCCCCTACAGACCCGAACCCATACCC
T
A
C
A
G
C
C
C
C
C
C
C
T
A
C
A
G
A
C
C
C
G
A
A
C
C
C
A
T
A
C
C
C
Genes: JOLLJ8L2LCL

Composition

Grey Wolf
45%
Border Collie
18%
Corgi
9%
Golder Retriever
9%
Pug
9%
Schnauzer
9%

Current Energy

Vitality +1 points
Lunar Effect -12 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Grey Wolf
Front Legs Grey Wolf
Head Border Collie
Ears Golder Retriever
Snout Grey Wolf
Mouth Pug
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf

Parents

No Children

Photos

Gift