Joe Jasper Bitcoin Dog - Mix of Grey Wolf, Border Collie, Shiba Inu, Pitbull terrier and Schnauzer
Joe Jasper
  • Purity 36%
  • Age 4 months
  • Racing Exp 0
  • Grey Wolf 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

I was born in the web cloud. I like nibbling on most everything, but I'll bite if you want me to. When my human brushes my coat, I get frisky! I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! My favorite thing is to sit in my humans' laps while they are trying to read or drive.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACCCCCCCCCCGTACCCCCCTCCCCCATACCC
T
A
C
C
C
C
C
C
C
C
C
C
G
T
A
C
C
C
C
C
C
T
C
C
C
C
C
A
T
A
C
C
C
Genes: JLLLELLNLCL

Composition

Grey Wolf
64%
Border Collie
9%
Shiba Inu
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality -13 points
Lunar Effect -12 points

Traits Breakdown

Body Border Collie
Tail Grey Wolf
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Grey Wolf
Mouth Pitbull terrier
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf