Shadow Speedo Digital Cryptocurrency Dog - Mix of Rottweiler, Pug, St. Bernard, Grey Wolf, German Shepard, Dachshund, Yorkshire Terrier, French Bulldog, Poodle and Schnauzer
Shadow Speedo
  • Purity 1%
  • Age 6 months
  • Racing Exp 0
  • Rottweiler 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Wassup? Yo, call me Shadow Speedo. My humans say I bark too much, but I have a lot to say! If you have fleas or ticks, don't bother. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I like never worrying about my dog poo. I've got people for that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAATGACACCCCTCAGGATTACACCGAGACATA
G
A
A
T
G
A
C
A
C
C
C
C
T
C
A
G
G
A
T
T
A
C
A
C
C
G
A
G
A
C
A
T
A
Genes: 2BHL7AFH9IC

Composition

Rottweiler
18%
Pug
9%
St. Bernard
9%
Grey Wolf
9%
German Shepard
9%
Dachshund
9%
Yorkshire Terrier
9%
French Bulldog
9%
Poodle
9%
Schnauzer
9%

Current Energy

Vitality -23 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail St. Bernard
Legs Rottweiler
Front Legs Grey Wolf
Head German Shepard
Ears Dachshund
Snout Yorkshire Terrier
Mouth Rottweiler
Nose French Bulldog
Eyes Poodle
Color Schnauzer

Parents

No Children

Gift