Li'l Sebastian Litecoin Dog - Mix of Yorkshire Terrier, Maltese, Beagle, French Bulldog, Labrador, Corgi, Schnauzer, Dachshund, Border Collie and Pitbull terrier
Li'l Sebastian
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

You can call me Li'l Sebastian, everybody else does. I'm an avid runner! Outside, inside, all over the place! I just want to run! I don't understand why I like smelling butts... I don't like having to stay off the furniture. Looking for that special tail wag.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCCTACGACCAAGCTTAATAGGATACTCCTTA
A
C
C
C
T
A
C
G
A
C
C
A
A
G
C
T
T
A
A
T
A
G
G
A
T
A
C
T
C
C
T
T
A
Genes: KD95OFCAJNF

Composition

Yorkshire Terrier
18%
Maltese
9%
Beagle
9%
French Bulldog
9%
Labrador
9%
Corgi
9%
Schnauzer
9%
Dachshund
9%
Border Collie
9%
Pitbull terrier
9%

Current Energy

Vitality -26 points
Lunar Effect -6 points

Traits Breakdown

Body Maltese
Tail Beagle
Legs French Bulldog
Front Legs Labrador
Head Corgi
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Dachshund
Nose Border Collie
Eyes Pitbull terrier
Color Yorkshire Terrier

Parents

No Children

Gift