Frodo Fulgore Litecoin Game Dog - Mix of Grey Wolf, Border Collie, Shiba Inu, Golder Retriever and Schnauzer
Frodo Fulgore
  • Purity 36%
  • Age 5 months
  • Racing Exp 0
  • Grey Wolf 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I'll lick anything. My bark alone scares birds out of my yard. Steak is my absolute favorite, but I prefer to eat chicken for my health.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACCCCCCCCCCGTACCCCCCAGACCCATACCC
T
A
C
C
C
C
C
C
C
C
C
C
G
T
A
C
C
C
C
C
C
A
G
A
C
C
C
A
T
A
C
C
C
Genes: JLLLELL8LCL

Composition

Grey Wolf
64%
Border Collie
9%
Shiba Inu
9%
Golder Retriever
9%
Schnauzer
9%

Current Energy

Vitality -13 points
Lunar Effect -12 points

Traits Breakdown

Body Border Collie
Tail Grey Wolf
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Grey Wolf
Mouth Golder Retriever
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf