Kobe Katniss Digital Cryptocurrency Dog - Mix of Border Collie, Pug, Schnauzer, Golder Retriever, Rottweiler and Poodle
Kobe Katniss
  • Purity 9%
  • Age 12 months
  • Racing Exp 62
  • Border Collie 18%
  • Gold medal 2 Silver medal 2 Bronze medal 4
  • 16 races
  • Gen 2
Sad & Tardy

Achievements

Racer
Podium Champion

Bio

Hola! My name is Kobe Katniss. I was born in the web cloud. Too much steak gives me the runs! I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! When I can break free, I enjoy exploring my neighborhood without my human.

Racing Stats

Ran 16 races
  • 2 2 4
 Best Time14.48 sec
Rank 28  RacingĀ *** LTC
50.0 % wins (8) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACGAAGACATATACAGAAGAGAACACATACAC
T
A
C
G
A
A
G
A
C
A
T
A
T
A
C
A
G
A
A
G
A
G
A
A
C
A
C
A
T
A
C
A
C
Genes: J2ICJ882HCH

Composition

Border Collie
18%
Pug
18%
Schnauzer
18%
Golder Retriever
18%
Rottweiler
18%
Poodle
9%

Current Energy

Vitality -34 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Poodle
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Pug
Nose Rottweiler
Eyes Schnauzer
Color Rottweiler