Sideline Shaggy Litecoin Game Dog - Mix of Beagle, German Shepard, Grey Wolf, French Bulldog, Maltese, Poodle, Border Collie, Pitbull terrier and Dachshund
Sideline Shaggy
  • Purity 3%
  • Age 15 months
  • Racing Exp 0
  • Beagle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Neutral & Tardy

Achievements

None

Bio

I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm looking for a poodle in the streets, and a bulldog in the sheets!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATCACCCCGAACCCTAGACTACTCCTCAGGA
C
T
A
T
C
A
C
C
C
C
G
A
A
C
C
C
T
A
G
A
C
T
A
C
T
C
C
T
C
A
G
G
A
Genes: D7L9KDIJN7A

Composition

Beagle
18%
German Shepard
18%
Grey Wolf
9%
French Bulldog
9%
Maltese
9%
Poodle
9%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Grey Wolf
Front Legs French Bulldog
Head Maltese
Ears Beagle
Snout Poodle
Mouth Border Collie
Nose Pitbull terrier
Eyes German Shepard
Color Dachshund