Bailey Bork Litecoin Dog - Mix of Husky, Pitbull terrier, Shiba Inu, Poodle, Golder Retriever, French Bulldog, Boxer and Border Collie
Bailey Bork
  • Purity 4%
  • Age 9 months
  • Racing Exp 31
  • Husky 18%
  • Gold medal 1 Silver medal 2 Bronze medal 1
  • 7 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Size matters. This dawg's into big databases. Long or short hair works for me, just no baldies please. I really enjoy heavy petting. The place I like most in the world is curled up in my human's bed, hogging all the covers! My humans say I bark too much, but I have a lot to say!

Racing Stats

Ran 7 races
  • 1 2 1
 Best Time14.77 sec
No rank  RacingĀ *** LTC
57.1 % wins (4) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAGACACAAGATCCGTATCCGTACGAAACTAC
A
C
A
G
A
C
A
C
A
A
G
A
T
C
C
G
T
A
T
C
C
G
T
A
C
G
A
A
A
C
T
A
C
Genes: 4I48NENE9GJ

Composition

Husky
18%
Pitbull terrier
18%
Shiba Inu
18%
Poodle
9%
Golder Retriever
9%
French Bulldog
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality -17 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears Shiba Inu
Snout Pitbull terrier
Mouth Shiba Inu
Nose French Bulldog
Eyes Boxer
Color Border Collie