Hercules Holden Bitcoin Dog - Mix of Grey Wolf, Border Collie, Golder Retriever, Corgi, St. Bernard and Schnauzer
Hercules Holden
  • Purity 12%
  • Age 12 months
  • Racing Exp 16
  • Grey Wolf 36%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 4 races
  • Gen 2
Sad & Tardy

Achievements

Racer

Bio

I was born in the web cloud. I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I love a good book... I find them quite tasty. I'm a serial monogamist. Blue toilet water turns me off.

Racing Stats

Ran 4 races
  • 1 0 1
 Best Time15.12 sec
Rank 67  RacingĀ *** LTC
50.0 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACAGCCCCTGATACAGACCCAGACCCATACCC
T
A
C
A
G
C
C
C
C
T
G
A
T
A
C
A
G
A
C
C
C
A
G
A
C
C
C
A
T
A
C
C
C
Genes: JOLBJ8L8LCL

Composition

Grey Wolf
36%
Border Collie
18%
Golder Retriever
18%
Corgi
9%
St. Bernard
9%
Schnauzer
9%

Current Energy

Vitality -14 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Grey Wolf
Front Legs St. Bernard
Head Border Collie
Ears Golder Retriever
Snout Grey Wolf
Mouth Golder Retriever
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf