Charles Chloe Crypto Dog - Mix of Pug, Rottweiler, Boxer, Schnauzer, Labrador BK, Labrador, Pitbull terrier, Husky and Maltese
Charles Chloe
  • Purity 3%
  • Age 3 months
  • Racing Exp 26
  • Pug 18%
  • Gold medal 2 Silver medal 0 Bronze medal 1
  • 7 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hullo. My name is Charles Chloe. I'm not a bad dog, my data is just configured that way. I need laid otherwise I'm going to start agreeing with Grumpy Cat. Little Bow Wow is my favorite musician. I just assume he's a dog... I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 7 races
  • 2 0 1
 Best Time15.15 sec
No rank  RacingĀ *** LTC
42.9 % wins (3) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAAACCACATAGCACCAGAATCCCACACAACC
G
A
A
A
A
C
C
A
C
A
T
A
G
C
A
C
C
A
G
A
A
T
C
C
C
A
C
A
C
A
A
C
C
Genes: 2GHC652NH4K

Composition

Pug
18%
Rottweiler
18%
Boxer
9%
Schnauzer
9%
Labrador BK
9%
Labrador
9%
Pitbull terrier
9%
Husky
9%
Maltese
9%

Current Energy

Vitality -43 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Boxer
Legs Rottweiler
Front Legs Schnauzer
Head Labrador BK
Ears Labrador
Snout Pug
Mouth Pitbull terrier
Nose Rottweiler
Eyes Husky
Color Maltese