Byte Bug Bitcoin Game Dog - Mix of French Bulldog, Pug, Border Collie, Husky, Pitbull terrier, Shiba Inu, Yorkshire Terrier and Labrador
Byte Bug
  • Purity 4%
  • Age 9 months
  • Racing Exp 0
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Currently, I live on the information superhighway. Shy dogs that tuck tail bore me. Oh, go ahead. Pet me. I know you want to. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAACAGAACGATCCGTATACTTATACGAACCA
C
G
A
A
C
A
G
A
A
C
G
A
T
C
C
G
T
A
T
A
C
T
T
A
T
A
C
G
A
A
C
C
A
Genes: 9429NEJFJ25

Composition

French Bulldog
18%
Pug
18%
Border Collie
18%
Husky
9%
Pitbull terrier
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Labrador
9%

Current Energy

Vitality -55 points
Lunar Effect -6 points

Traits Breakdown

Body French Bulldog
Tail Husky
Legs Pug
Front Legs French Bulldog
Head Pitbull terrier
Ears Shiba Inu
Snout Border Collie
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Pug
Color Labrador

Parents

No Children

Gift