Fluffy Fred Digital Cryptocurrency Dog - Mix of Grey Wolf, Maltese, Yorkshire Terrier, German Shepard, Schnauzer, Pitbull terrier and St. Bernard
Fluffy Fred
  • Purity 9%
  • Age 16 months
  • Racing Exp 1
  • Grey Wolf 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Neutral & Casual

Achievements

Racer

Bio

I love waking up early then indulging in long afternoon naps. I'm not into dog collars, unless you're into S & M. As a designer, I suggest low windows or couch backs next to windows without curtains. The smell of fresh manure to roll in makes me wild.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.42 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCTCACCCCCCACCTTAATATTATCCTGAACC
C
C
C
T
C
A
C
C
C
C
C
C
A
C
C
T
T
A
A
T
A
T
T
A
T
C
C
T
G
A
A
C
C
Genes: L7LLKFCFNBK

Composition

Grey Wolf
27%
Maltese
18%
Yorkshire Terrier
18%
German Shepard
9%
Schnauzer
9%
Pitbull terrier
9%
St. Bernard
9%

Current Energy

Vitality 0 points
Lunar Effect +6 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Grey Wolf
Front Legs Grey Wolf
Head Maltese
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Yorkshire Terrier
Nose Pitbull terrier
Eyes St. Bernard
Color Maltese