Jess Jango Litecoin Dog - Mix of Boxer, Border Collie, Schnauzer, Golder Retriever, Shiba Inu, Labrador BK, Dachshund and German Shepard
Jess Jango
  • Purity 4%
  • Age 15 months
  • Racing Exp 0
  • Boxer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Tardy

Achievements

None

Bio

Jess Jango is the name, love is my game. And fetch of course... Currently, I live on the information superhighway. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I hate having to wear foo-foo clothes and ribbons in my fur. If we can run as a pack for a while, I'm open to that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAAACTACGTATACAACATAGCAGGATCAATA
A
G
A
A
A
C
T
A
C
G
T
A
T
A
C
A
A
C
A
T
A
G
C
A
G
G
A
T
C
A
A
T
A
Genes: 8GJEJGC6A7C

Composition

Boxer
18%
Border Collie
18%
Schnauzer
18%
Golder Retriever
9%
Shiba Inu
9%
Labrador BK
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -17 points
Lunar Effect -8 points

Traits Breakdown

Body Golder Retriever
Tail Boxer
Legs Border Collie
Front Legs Shiba Inu
Head Border Collie
Ears Boxer
Snout Schnauzer
Mouth Labrador BK
Nose Dachshund
Eyes German Shepard
Color Schnauzer