Tristan Turk Cryptocurrency Dog - Mix of Beagle, Dachshund, Pug, Husky, French Bulldog, Maltese, Corgi, Pitbull terrier and German Shepard
Tristan Turk
  • Purity 3%
  • Age 6 months
  • Racing Exp 1
  • Beagle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

In my digital world, cats aren't the only ones who hack. I cry whenever I hear an ambulance siren! Don't bother contacting me if you like cats. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.67 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAGAAACACGAACCCTAAGCGGATCCTCAGGA
C
T
A
G
A
A
A
C
A
C
G
A
A
C
C
C
T
A
A
G
C
G
G
A
T
C
C
T
C
A
G
G
A
Genes: D249KDOAN7A

Composition

Beagle
18%
Dachshund
18%
Pug
9%
Husky
9%
French Bulldog
9%
Maltese
9%
Corgi
9%
Pitbull terrier
9%
German Shepard
9%

Current Energy

Vitality -50 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Pug
Legs Husky
Front Legs French Bulldog
Head Maltese
Ears Beagle
Snout Corgi
Mouth Dachshund
Nose Pitbull terrier
Eyes German Shepard
Color Dachshund