Kong King Hippo Litecoin Dog - Mix of Border Collie, Pug, Schnauzer, Golder Retriever, Grey Wolf, German Shepard and Rottweiler
Kong King Hippo
  • Purity 8%
  • Age 18 months
  • Racing Exp 2
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 1
Sad & Tardy

Achievements

Racer

Bio

Hello, I be Kong King Hippo. If you have fleas or ticks, don't bother. I like it when you're frisky. As a designer, I suggest low windows or couch backs next to windows without curtains. Trust me. Leashes, collar and whips can be fun if you know what you're doing.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.22 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACGAACCCATATACAGAAGAGAATCAATACAC
T
A
C
G
A
A
C
C
C
A
T
A
T
A
C
A
G
A
A
G
A
G
A
A
T
C
A
A
T
A
C
A
C
Genes: J2LCJ8827CH

Composition

Border Collie
18%
Pug
18%
Schnauzer
18%
Golder Retriever
18%
Grey Wolf
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality -19 points
Lunar Effect +2 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Grey Wolf
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Pug
Nose German Shepard
Eyes Schnauzer
Color Rottweiler