Alaska Amethyst Litecoin Dog - Mix of Corgi, Yorkshire Terrier, Rottweiler, German Shepard, Poodle, Pug, Dachshund and Labrador
Alaska Amethyst
  • Purity 6%
  • Age 5 months
  • Racing Exp 4
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

How do you do? I'm Alaska Amethyst. I'll lick anything. I absolutely love long walks when I can stop and smell the bushes. Small yappy creatures bug me...they disturb my zen. Size doesn't matter, I like 'em all.

Racing Stats

Ran 4 races
  • 0 0 0
 Best Time15.92 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAAGCGACTTATTACACGAAAGCCACGGACCA
T
C
A
A
G
C
G
A
C
T
T
A
T
T
A
C
A
C
G
A
A
A
G
C
C
A
C
G
G
A
C
C
A
Genes: 7OIFFH2OHA5

Composition

Corgi
18%
Yorkshire Terrier
18%
Rottweiler
18%
German Shepard
9%
Poodle
9%
Pug
9%
Dachshund
9%
Labrador
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Poodle
Front Legs Yorkshire Terrier
Head Yorkshire Terrier
Ears Rottweiler
Snout Pug
Mouth Corgi
Nose Rottweiler
Eyes Dachshund
Color Labrador