Muffy Maddux Bitcoin Dog - Mix of Border Collie, Dachshund, Grey Wolf, Pug, Husky, Pitbull terrier, Yorkshire Terrier, Maltese and Rottweiler
Muffy Maddux
  • Purity 3%
  • Age 6 months
  • Racing Exp 3
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hi, Muffy Maddux is my name. Eat, sleep, poop. Honey, I've got it made. I like it when you're frisky. When I hook up, I stay hooked up for about 20 minutes. Small yappy creatures bug me...they disturb my zen.

Racing Stats

Ran 3 races
  • 0 0 0
 Best Time16.07 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCGAAACATACTCCGGATTATACACCGGACAC
C
C
C
G
A
A
A
C
A
T
A
C
T
C
C
G
G
A
T
T
A
T
A
C
A
C
C
G
G
A
C
A
C
Genes: L24JNAFJKAH

Composition

Border Collie
18%
Dachshund
18%
Grey Wolf
9%
Pug
9%
Husky
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
Maltese
9%
Rottweiler
9%

Current Energy

Vitality -8 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Pug
Legs Husky
Front Legs Border Collie
Head Pitbull terrier
Ears Dachshund
Snout Yorkshire Terrier
Mouth Border Collie
Nose Maltese
Eyes Dachshund
Color Rottweiler