Maddy Mister Miyagi Crypto Dog - Mix of Shiba Inu, Labrador BK, Beagle, Husky, Border Collie, Maltese, Pug, Labrador and Yorkshire Terrier
Maddy Mister Miyagi
  • Purity 3%
  • Age 11 months
  • Racing Exp 0
  • Shiba Inu 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

Barkjour mi amor! I'm Maddy Mister Miyagi. I am a guard dog for the data warehouse. If I can't reach it to clean it myself, it doesn't need cleaning! Slipping my collar, running off and making my humans worried? Every chance I get. I want to find that special friend who enjoys sharing each other's doggie bags.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAGTAACATACACCGAAGCACCATTAGCAGTA
C
T
A
G
T
A
A
C
A
T
A
C
A
C
C
G
A
A
G
C
A
C
C
A
T
T
A
G
C
A
G
T
A
Genes: DE4JK265F6E

Composition

Shiba Inu
18%
Labrador BK
18%
Beagle
9%
Husky
9%
Border Collie
9%
Maltese
9%
Pug
9%
Labrador
9%
Yorkshire Terrier
9%

Current Energy

Vitality -33 points
Lunar Effect -2 points

Traits Breakdown

Body Beagle
Tail Shiba Inu
Legs Husky
Front Legs Border Collie
Head Maltese
Ears Pug
Snout Labrador BK
Mouth Labrador
Nose Yorkshire Terrier
Eyes Labrador BK
Color Shiba Inu

Parents

No Children

Gift