Toby Tinker Bitcoin Game Dog - Mix of Poodle, Shiba Inu, French Bulldog, Border Collie, Grey Wolf, Pug, Labrador BK, Golder Retriever, German Shepard and Labrador
Toby Tinker
  • Purity 1%
  • Age 6 months
  • Racing Exp 6
  • Poodle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Suh? How's it goin? I'm Toby Tinker. As a digital dog, let me say Bob Dole did not invent the internet. Long or short hair works for me, just no baldies please. I'll outrun you for the ball if I can...that's just how I roll. Steak is my absolute favorite, but I prefer to eat chicken for my health.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time16.00 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACGTACGATACCCCGAAGCAGACAGATCACCA
G
A
C
G
T
A
C
G
A
T
A
C
C
C
C
G
A
A
G
C
A
G
A
C
A
G
A
T
C
A
C
C
A
Genes: IE9JL26I875

Composition

Poodle
18%
Shiba Inu
9%
French Bulldog
9%
Border Collie
9%
Grey Wolf
9%
Pug
9%
Labrador BK
9%
Golder Retriever
9%
German Shepard
9%
Labrador
9%

Current Energy

Vitality -38 points
Lunar Effect -10 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs French Bulldog
Front Legs Border Collie
Head Grey Wolf
Ears Pug
Snout Labrador BK
Mouth Poodle
Nose Golder Retriever
Eyes German Shepard
Color Labrador