Johnny Jak Litecoin Game Dog - Mix of Maltese, Labrador, Golder Retriever, Poodle, Shiba Inu, Schnauzer, Yorkshire Terrier and St. Bernard
Johnny Jak
  • Purity 6%
  • Age 13 months
  • Racing Exp 1
  • Maltese 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

I'm Johnny Jak. What do they call you? Shy dogs that tuck tail bore me. My favorite way to relax is to be scratched on my belly. When I can break free, I enjoy exploring my neighborhood without my human. If you are looking for a pooch who's in touch with feelings, here I am.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.42 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGACCAACCGACACCGTAATATTACCATGAACC
A
G
A
C
C
A
A
C
C
G
A
C
A
C
C
G
T
A
A
T
A
T
T
A
C
C
A
T
G
A
A
C
C
Genes: 85KIKECF5BK

Composition

Maltese
27%
Labrador
18%
Golder Retriever
9%
Poodle
9%
Shiba Inu
9%
Schnauzer
9%
Yorkshire Terrier
9%
St. Bernard
9%

Current Energy

Vitality -42 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs Maltese
Front Legs Poodle
Head Maltese
Ears Shiba Inu
Snout Schnauzer
Mouth Yorkshire Terrier
Nose Labrador
Eyes St. Bernard
Color Maltese