Ivan Ivy Cryptocurrency Game Dog - Mix of Corgi, Grey Wolf, Beagle, Yorkshire Terrier, St. Bernard, Pug, Golder Retriever, Labrador and Labrador BK
Ivan Ivy
  • Purity 3%
  • Age 13 months
  • Racing Exp 15
  • Corgi 18%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 1
Sad & Tardy

Achievements

Racer

Bio

Ima cyber dog. My favorite way to relax is to be scratched on my belly. Shy dogs that tuck tail bore me. As a perfectionist, I have to find just the right 'spot'. I never knew my father.

Racing Stats

Ran 2 races
  • 1 1 0
 Best Time15.83 sec
No rank  RacingĀ *** LTC
100.0 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAAGCTTATGACCCGAAAGCAGACCAGCACCC
C
T
A
A
G
C
T
T
A
T
G
A
C
C
C
G
A
A
A
G
C
A
G
A
C
C
A
G
C
A
C
C
C
Genes: DOFBL2O856L

Composition

Corgi
18%
Grey Wolf
18%
Beagle
9%
Yorkshire Terrier
9%
St. Bernard
9%
Pug
9%
Golder Retriever
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -50 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Corgi
Legs Yorkshire Terrier
Front Legs St. Bernard
Head Grey Wolf
Ears Pug
Snout Corgi
Mouth Golder Retriever
Nose Labrador
Eyes Labrador BK
Color Grey Wolf

Parents

No Children

Photos

Bitcoin doggy racing virtual doggy racing podium
Gift