Buck Bolt Cryptocurrency Dog - Mix of Beagle, Corgi, Husky, St. Bernard, Maltese, Pug, Rottweiler, Labrador, Yorkshire Terrier, Labrador BK and Shiba Inu
Buck Bolt
  • Purity 0%
  • Age 5 months
  • Racing Exp 6
  • Mixed-breed
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

How YOU doin'? Buck Bolt here. I live inside of a Virtual machine two steps to the right from the firewall. Size doesn't matter, I like 'em all. Don't bother contacting me if you like cats. Rolling around on the carpet after a bath is my favorite way to dry. I'm just looking for some puppy love.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time16.02 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAAGCACATGAACCGAACACCCATTAGCAGTA
C
T
A
A
G
C
A
C
A
T
G
A
A
C
C
G
A
A
C
A
C
C
C
A
T
T
A
G
C
A
G
T
A
Genes: DO4BK2H5F6E

Composition

Beagle
9%
Corgi
9%
Husky
9%
St. Bernard
9%
Maltese
9%
Pug
9%
Rottweiler
9%
Labrador
9%
Yorkshire Terrier
9%
Labrador BK
9%
Shiba Inu
9%

Current Energy

Vitality -45 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Corgi
Legs Husky
Front Legs St. Bernard
Head Maltese
Ears Pug
Snout Rottweiler
Mouth Labrador
Nose Yorkshire Terrier
Eyes Labrador BK
Color Shiba Inu