Knuckles Kyra Litecoin Dog - Mix of Beagle, Shiba Inu, Maltese, Labrador, Boxer, Rottweiler and German Shepard
Knuckles Kyra
  • Purity 7%
  • Age 13 months
  • Racing Exp 29
  • Beagle 27%
  • Gold medal 0 Silver medal 2 Bronze medal 2
  • 7 races
  • Gen 1
Sad & Tardy

Achievements

Racer

Bio

I hate it when I am not the center of attention. I think hamsters and cats are both over-rated. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I enjoy crunchy kibble and drinking from toilets.

Racing Stats

Ran 7 races
  • 0 2 2
 Best Time15.52 sec
Rank 78  RacingĀ *** LTC
57.1 % wins (4) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTACCAGTAACCCTAAACCACCTAACCTCACTA
G
T
A
C
C
A
G
T
A
A
C
C
C
T
A
A
A
C
C
A
C
C
T
A
A
C
C
T
C
A
C
T
A
Genes: E5EKDGHDK7D

Composition

Beagle
27%
Shiba Inu
18%
Maltese
18%
Labrador
9%
Boxer
9%
Rottweiler
9%
German Shepard
9%

Current Energy

Vitality -65 points
Lunar Effect +10 points

Traits Breakdown

Body Shiba Inu
Tail Labrador
Legs Shiba Inu
Front Legs Maltese
Head Beagle
Ears Boxer
Snout Rottweiler
Mouth Beagle
Nose Maltese
Eyes German Shepard
Color Beagle

Parents

No Children

Photos

Litecoin pet racing virtual dog racing results cryptocurrency pet race Litecoin dog racing podium
Gift