Nightwolf Norma Crypto Dog - Mix of German Shepard, Golder Retriever, Pug, Husky, Schnauzer, Maltese, Labrador, Labrador BK and Rottweiler
Nightwolf Norma
  • Purity 5%
  • Age 6 months
  • Racing Exp 31
  • German Shepard 18%
  • Gold medal 2 Silver medal 1 Bronze medal 1
  • 6 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

I live in your digital dreams. I enjoy staying active, and running circles around puppies and young children. I'll lick anything. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 6 races
  • 2 1 1
 Best Time14.53 sec
No rank  RacingĀ *** LTC
66.7 % wins (4) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAGAAAGAAGAACATCAATAACCCCAGCACAC
T
C
A
G
A
A
A
G
A
A
G
A
A
C
A
T
C
A
A
T
A
A
C
C
C
C
A
G
C
A
C
A
C
Genes: 728847CK56H

Composition

German Shepard
18%
Golder Retriever
18%
Pug
9%
Husky
9%
Schnauzer
9%
Maltese
9%
Labrador
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -18 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Golder Retriever
Front Legs Golder Retriever
Head Husky
Ears German Shepard
Snout Schnauzer
Mouth Maltese
Nose Labrador
Eyes Labrador BK
Color Rottweiler