Chico Chief Bitcoin Dog - Mix of Shiba Inu, Poodle, Beagle, Maltese, German Shepard, Boxer, Golder Retriever and Border Collie
Chico Chief
  • Purity 4%
  • Age 18 months
  • Racing Exp 7
  • Shiba Inu 18%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

Salutations! My name's Chico Chief. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) Size doesn't matter, I like 'em all. People food disagrees with me. Whew! You can tell. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time14.67 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGACGTAACCTCAAACGACCTAAGATACCTA
G
T
A
G
A
C
G
T
A
A
C
C
T
C
A
A
A
C
G
A
C
C
T
A
A
G
A
T
A
C
C
T
A
Genes: EIEK7GID8JD

Composition

Shiba Inu
18%
Poodle
18%
Beagle
18%
Maltese
9%
German Shepard
9%
Boxer
9%
Golder Retriever
9%
Border Collie
9%

Current Energy

Vitality -41 points
Lunar Effect -10 points

Traits Breakdown

Body Shiba Inu
Tail Poodle
Legs Shiba Inu
Front Legs Maltese
Head German Shepard
Ears Boxer
Snout Poodle
Mouth Beagle
Nose Golder Retriever
Eyes Border Collie
Color Beagle