Shady Snoopy Crypto Game Dog - Mix of Dachshund, Labrador, German Shepard, Rottweiler, Golder Retriever, St. Bernard, Pug, Corgi, Border Collie and Yorkshire Terrier
Shady Snoopy
  • Purity 1%
  • Age 7 months
  • Racing Exp 1
  • Dachshund 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

I live life by my favorite quote "Every dog has it's day", but every day is my day! It doesn't matter to me which team I play for... I just like tail. I never met a crotch or a butt I didn't like, but I'm just friendly that way. Peanut butter is delish but I HATE when it sticks to the roof of my mouth.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.93 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCATCACACAGATGAGAAGGAAGCTACTTAGGA
C
C
A
T
C
A
C
A
C
A
G
A
T
G
A
G
A
A
G
G
A
A
G
C
T
A
C
T
T
A
G
G
A
Genes: 57H8B2AOJFA

Composition

Dachshund
18%
Labrador
9%
German Shepard
9%
Rottweiler
9%
Golder Retriever
9%
St. Bernard
9%
Pug
9%
Corgi
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -20 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail German Shepard
Legs Rottweiler
Front Legs Golder Retriever
Head St. Bernard
Ears Pug
Snout Dachshund
Mouth Corgi
Nose Border Collie
Eyes Yorkshire Terrier
Color Dachshund

Parents

No Children

Photos

Gift