Patty Pepsi Crypto Dog - Mix of Golder Retriever, Labrador BK, St. Bernard, Husky, Boxer, Pug, German Shepard, Grey Wolf, Corgi and Rottweiler
Patty Pepsi
  • Purity 3%
  • Age 9 months
  • Racing Exp 0
  • Golder Retriever 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

Have you ever dated a digital creation before? You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. Fences are just challenges...I don't let them stop me! I want to find that special friend who enjoys sharing each other's doggie bags.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCATGAAGAAGAACAAACGAATCACCCAGCCAC
G
C
A
T
G
A
A
G
A
A
G
A
A
C
A
A
A
C
G
A
A
T
C
A
C
C
C
A
G
C
C
A
C
Genes: 6B884G27LOH

Composition

Golder Retriever
18%
Labrador BK
9%
St. Bernard
9%
Husky
9%
Boxer
9%
Pug
9%
German Shepard
9%
Grey Wolf
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality -12 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs Golder Retriever
Front Legs Golder Retriever
Head Husky
Ears Boxer
Snout Pug
Mouth German Shepard
Nose Grey Wolf
Eyes Corgi
Color Rottweiler